Generation of recombinant baculovirus
The recombinant baculoviruses BEV rep2/cap8, BEV rep2/capAnc80 and BEV ITR-GFP were generated using either the kit Bac-to-Bac® (ThermoFisher Scientific, MA) for the Tn7 system or the BacMagic-2 (Merck Millipore) or flashBAC GOLD (Oxford Expression Technologies, Oxford, England) kit for the HR-based system.
Tn7 site-specific transposition of the cassette from donor plasmid pFastBac1 (pFB) to the bacmid backbone derived from bMON14272 was performed by transformation of 10 ng of the donor plasmid inEscherichia coli DH10Bac competent bacteria in accordance with the instructions of the supplier (Bac-to-Bac® user guide, ThermoFisher Scientific, MA). The recombinant bacmid was validated for the presence of the cassette by PCR using the set of primers M13-pUC-F 5’- CCAGTCACGACGTTGTAAAACG and M13-pUC-R 5’- AGCGGATAACAATTTCACACAGG from either side of the insert and the set of primers M13-pUC-F and BAC-G 5’- AGCCACCTACTCCCAACATC targeting the selective gene sequence of the cassette, and then confirmed by Sanger sequencing. One microgram of Tn7-bacmid DNA was then transfected in 1ml of Sf9 insect cells at a density of 1x106 cells/ml cultivated in 6-wells plate, using 9µl of Cellfectin-II reagent (Thermo Fisher Scientific, MA). The supernatant (P0) was harvested at 96 hours post-transfection. Baculoviral clones are isolated from the P0 stock by plaque assay and five of them are amplified in T25 flask (P1) before to perform up to ten serial passages in order to validate the genetic stability of the cassette. When meeting specifications, i.e. sequence identity and genetic stability, a unique clone is selected, and a larger stock is then generated by amplification in Sf9 insect cells seeded in spinner-flask (P2).
Homologous recombination occurred by transfecting 500ng of linearized donor plasmid derived from the pBac-1 and 100ng of the HR-bacmid in 1ml of Sf9 insect cells at a density of 1x106 cells/ml cultivated in 6-wells plate and using 5µl of Cellfectin-II reagent in accordance with the instructions of the supplier (BacMagic-2 user guide, Merck Millipore, Billerica, MA). As previously described, the supernatant (P0) was recovered 96 hours post-transfection and five clones were then amplified and characterized equally up to P2 stock.