Generation of recombinant baculovirus
The recombinant baculoviruses BEV rep2/cap8, BEV rep2/capAnc80 and BEV
ITR-GFP were generated using either the kit Bac-to-Bac® (ThermoFisher
Scientific, MA) for the Tn7 system or the BacMagic-2 (Merck Millipore)
or flashBAC GOLD (Oxford Expression Technologies, Oxford, England) kit
for the HR-based system.
Tn7 site-specific transposition of the cassette from donor plasmid
pFastBac1 (pFB) to the bacmid backbone derived from bMON14272 was
performed by transformation of 10 ng of the donor plasmid inEscherichia coli DH10Bac competent bacteria in accordance with
the instructions of the supplier (Bac-to-Bac® user
guide, ThermoFisher Scientific, MA). The recombinant bacmid was
validated for the presence of the cassette by PCR using the set of
primers M13-pUC-F 5’- CCAGTCACGACGTTGTAAAACG and M13-pUC-R 5’-
AGCGGATAACAATTTCACACAGG from either side of the insert and the set of
primers M13-pUC-F and BAC-G 5’- AGCCACCTACTCCCAACATC targeting the
selective gene sequence of the cassette, and then confirmed by Sanger
sequencing. One microgram of Tn7-bacmid DNA was then transfected in 1ml
of Sf9 insect cells at a density of 1x106 cells/ml
cultivated in 6-wells plate, using 9µl of Cellfectin-II reagent (Thermo
Fisher Scientific, MA). The supernatant (P0) was harvested at 96 hours
post-transfection. Baculoviral clones are isolated from the P0 stock by
plaque assay and five of them are amplified in T25 flask (P1) before to
perform up to ten serial passages in order to validate the genetic
stability of the cassette. When meeting specifications, i.e. sequence
identity and genetic stability, a unique clone is selected, and a larger
stock is then generated by amplification in Sf9 insect cells seeded in
spinner-flask (P2).
Homologous recombination occurred by transfecting 500ng of linearized
donor plasmid derived from the pBac-1 and 100ng of the HR-bacmid in 1ml
of Sf9 insect cells at a density of 1x106 cells/ml
cultivated in 6-wells plate and using 5µl of Cellfectin-II reagent in
accordance with the instructions of the supplier (BacMagic-2 user
guide, Merck Millipore, Billerica, MA). As previously described, the
supernatant (P0) was recovered 96 hours post-transfection and five
clones were then amplified and characterized equally up to P2 stock.