PCR amplification and sequencing
The entire sequences of the atp H gene of B810S and 810S with specificity primers atp H-F(AAGGATGGAATGAAAGATNAG), andatp H-R (GCTTTTATTTGCGAACCCTTT
-TGTTTAA) was amplified by polymerase chain reaction (PCR). The PCR reactions contained ~20 ng of genomic DNA and were carried out in 50-μL reaction volumes containing 25 μL of 2×Phusion EmwealdAmp MAX HS PCR Master Mix (TaKaRa, Dalian, China), 2 μL of each primer, 2 μL of DNA and 19 μL of ddH2O and 2 µL of DNA sample in a thermocycler (Biometra, Göttingen, German). The PCR conditions were as follows: At the beginning of the preheat temperature 94°C for 5 min, followed by 35 cycles of denaturation at 94°C for 30 s; annealing at 50°C for 30 s, and extension temperature at 72°C for 2 min, with a final extension at 72°C for 5 min. All products of PCR amplification were detected by 1.5% agarose gel electrophoresis to validate the amplification efficiency. The PCR products were sent to BGI-Shenzhen (Shenzhen, China) for sequencing from both directions.