2.3 Nucleic Acid Detection of SARS-CoV-2
All RNA samples were identified with nucleic acid detection of SARS-CoV-2 using real-time RT-PCR based on the recommendation by the China CDC (http://ivdc.chinacdc.cn /kyjz/202001/t20200121_211337.html). Briefly, two target genes, including nucleoprotein (N) gene and open reading frame (ORF) 1ab, were simultaneously amplified and tested during the real-time RT-PCR assay. Target 1 (N): forward primer GGGGAACTTCTCCTGCTAGAAT; reverse primer CAGACATTTTGCTCTCAAGCTG; and the probe 5′-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3′. Target 2 (ORF1ab): forward primer CCCTGTGGGTTTTACACTTAA; reverse primer ACGATTGTGC ATCAGCTGA; and the probe 5′-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1–3′. The criteria for confirmed diagnosis of SARS-CoV-2 were that both two genes amplified to be positive for N and ORF 1ab gene.