Construction of plasmids
To construct eEF2 plasmids, the cDNAs were synthesized from total RNA (4 μg) of MCF10A cells, using the Super Script IV reverse transcriptase (Life Technologies). The human eEF2 gene was delivered to pcDNA3.1 His6C vector, using BamHI and XhoI restriction enzyme site. The domains of the GTP binding motifs were analyzed using Uniport analyzer (https://www.uniprot.org/uniprot/P13639). The following primers were used: human eEF2, forward: 5’-GACGGATCC GCCACCATGGTGAACTTCACGGTAG-3’; reverse: 5’- ACCTCGA G CGGCTACAATTTGTCCAGGAAGTTG-3’. eEF2 GTP binding motif mutant (CATCAACCT CATTGACTCCCCCGGGCAT GTCGACTTCTCCT): forward: 5’-CATCAACCTCATTGTCGAC TTCTCCTCG-3’; reverse: 5’-CGAGGAGAAGTCGACAATGAGGTTGATG-3’. To produce eEF2-GST fusion protein, the vectors of eEF2 and eEF2 GTP binding mutant were digested by BamHI and XhoI and subcloned into pGEX-4T-2 vector. To produce Drp1-GST fusion protein, the human Drp1 gene from pGW1-Drp (20 ) was amplified by PCR using the following primers; forward: 5’-TTTGGATCC ATGGAGGCGCTAATTCC-3’ and reverse: 5’-TTTCTCGAG TCACC AAAGATGAGTCTCCC-3’ and then cloned into pGEX-4T-2 vector.
The plasmid of eEF2 RNAi-resistant mutant was prepared using two-step PCR techniques as previously reported. (21 ) Briefly, the construct was amplified using the following primers: 5’- AAGGTGTTTGATGCGATCATGAAC TTT AAA AAAGAGGA-3’ (forward) and 5’- TCCTCTTTT T TAA AGT TCATGATCGCATCAAACACCTT-3’ (reverse). Three nucleotides in the target sequence of siRNA were changed, and the resultant human eEF2 cDNAs was then subcloned into pcDNA3.1-His 6C vector. In this RNAi-resistant mutant, the target sequence, GAAT TTC AAG AAA, was mutated with 3 synonymous, single nucleotide polymorphisms to the following sequence: GAAAAC TTT AAA AAA.