2.3 │ Primers and PCR Amplification
A pair of universal primers (ALV-F/R) , targeting env and LTR, was
adopted to detect exogenous ALVs as previously
reported
(ALV-F:GATGAGGCGAGCCCTCTCTTTG/ALV-R: TGTGGTGGGAGGTAAAATGGCGT).
DNA was extracted from the DF-1 cells. The conditions for PCR with
primers ALV-F/R were as follows: 95°C for 5 min; followed by 31 cycles
of 95°C for 50 s, 55°C for 40 s, and 72°C for 140 s; with a final
elongation step of 10 min at 72°C. The PCR product was analyzed by
electrophoresis in 0.8% agarose in Tris-acetate-EDTA buffer. Molecular
cloning of positive amplicons was performed and positive clones were
confirmed and subjected to Sanger sequencing.