2.3 │ Primers and PCR Amplification
A pair of universal primers (ALV-F/R) , targeting env and LTR, was adopted to detect exogenous ALVs as previously reported (ALV-F:GATGAGGCGAGCCCTCTCTTTG/ALV-R: TGTGGTGGGAGGTAAAATGGCGT). DNA was extracted from the DF-1 cells. The conditions for PCR with primers ALV-F/R were as follows: 95°C for 5 min; followed by 31 cycles of 95°C for 50 s, 55°C for 40 s, and 72°C for 140 s; with a final elongation step of 10 min at 72°C. The PCR product was analyzed by electrophoresis in 0.8% agarose in Tris-acetate-EDTA buffer. Molecular cloning of positive amplicons was performed and positive clones were confirmed and subjected to Sanger sequencing.