PCR amplification
The PCR amplification reaction was accomplished in 0.2 mL tubes using AccuPower PCR PreMix. The reaction mixture consisted of 5 μL DNA, 1 µL (10 pmol) forward primer AACGTCAACCCCTTCAACTACC, and 1 µL (10 pmol) reverse primer TTGCCTGTGGCGAAAGGCG. The volume was then completed to 20 µL using DEPC-H2O. The thermocycler was programmed to start with an initial denaturation at 94 °C for 5 minutes. Then, 35 cycles of denaturation at 94°C for 30 seconds, annealing at 56 °C for 30 seconds, and elongation at 72 °C for 90 seconds followed. The final elongation temperature was 72 °C for 10 minutes.